View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18521_high_39 (Length: 209)
Name: NF18521_high_39
Description: NF18521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18521_high_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 55 - 176
Target Start/End: Complemental strand, 51994861 - 51994740
Alignment:
| Q |
55 |
gttgggctctgttttgtatagtctcttttgattcaggtgttgatattttttcccgtagtttcctaaacatcacaaatgaaattatatactcaaattaggg |
154 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51994861 |
gttgggctctgttctgtatagtctcttttgattcaggtgttgatattttttcccgtagtttcctaaacagcacaaatgaaattatatactcaaattaggg |
51994762 |
T |
 |
| Q |
155 |
gggtcaattattaatactacca |
176 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
51994761 |
gggttaattattaatactacca |
51994740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 58
Target Start/End: Complemental strand, 51994908 - 51994871
Alignment:
| Q |
21 |
acaatccatgtgcagcagaatgaatagtttatgtgttg |
58 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51994908 |
acaatccatgtgcagcagaatgaataatttatgtgttg |
51994871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University