View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18521_high_39 (Length: 209)

Name: NF18521_high_39
Description: NF18521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18521_high_39
NF18521_high_39
[»] chr3 (2 HSPs)
chr3 (55-176)||(51994740-51994861)
chr3 (21-58)||(51994871-51994908)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 55 - 176
Target Start/End: Complemental strand, 51994861 - 51994740
Alignment:
55 gttgggctctgttttgtatagtctcttttgattcaggtgttgatattttttcccgtagtttcctaaacatcacaaatgaaattatatactcaaattaggg 154  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
51994861 gttgggctctgttctgtatagtctcttttgattcaggtgttgatattttttcccgtagtttcctaaacagcacaaatgaaattatatactcaaattaggg 51994762  T
155 gggtcaattattaatactacca 176  Q
    |||| |||||||||||||||||    
51994761 gggttaattattaatactacca 51994740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 58
Target Start/End: Complemental strand, 51994908 - 51994871
Alignment:
21 acaatccatgtgcagcagaatgaatagtttatgtgttg 58  Q
    |||||||||||||||||||||||||| |||||||||||    
51994908 acaatccatgtgcagcagaatgaataatttatgtgttg 51994871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University