View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18521_low_17 (Length: 338)
Name: NF18521_low_17
Description: NF18521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18521_low_17 |
 |  |
|
| [»] scaffold0042 (1 HSPs) |
 |  |  |
|
| [»] scaffold0534 (1 HSPs) |
 |  |  |
|
| [»] scaffold0599 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 16 - 321
Target Start/End: Complemental strand, 3234207 - 3233901
Alignment:
| Q |
16 |
attagagtgcgtttgcaacaatttaatctcacattctcatccttacggagtcgagaagacttt-attaccttacaattatctacgtaccatattatacaa |
114 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
3234207 |
attagagtgtgtttgcaacgatttaatctcacattctcgttcttacggagtcgagaagacttttattaccttacaattatctacgtaccatattatagaa |
3234108 |
T |
 |
| Q |
115 |
atatgtgtaagttaacataccttccaatggaatagtcttgccgattgatgtagtcaccgaattttttcacaaaatctttcttcaaatctgcatcactgac |
214 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3234107 |
atatgtataagttaacataccttccaatggaatagtcttgccgattgatgtagtcactgaattttttcacaaaatctttcttcaaatctgcatcactgac |
3234008 |
T |
 |
| Q |
215 |
ataagatgtaattgtctcaagcaatgctgttgttttggcccatgcaagtctctcttgagacctttcaggctcaaatatgcttgctgctgccaaaaagtag |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3234007 |
ataagatgtaattgtctcaagcaatgctgttgttttggcccatgcaagtctctcatgagacctttcaggctcaaatatgtttgctgctgccaaaaagtag |
3233908 |
T |
 |
| Q |
315 |
gccaata |
321 |
Q |
| |
|
||||||| |
|
|
| T |
3233907 |
gccaata |
3233901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 138 - 315
Target Start/End: Original strand, 3179356 - 3179533
Alignment:
| Q |
138 |
ccaatggaatagtcttgccgattgatgtagtcaccgaattttttcacaaaatctttcttcaaatctgcatcactgacataagatgtaattgtctcaagca |
237 |
Q |
| |
|
|||||||||| |||| |||| |||||||||||| | |||| || ||||| ||||||||||||||| |||| || | |||||| |||| ||||| ||||| |
|
|
| T |
3179356 |
ccaatggaatggtctcgccggttgatgtagtcattgtatttgttaacaaagtctttcttcaaatcttcatccctaatataagaagtaaatgtctgaagca |
3179455 |
T |
 |
| Q |
238 |
atgctgttgttttggcccatgcaagtctctcttgagacctttcaggctcaaatatgcttgctgctgccaaaaagtagg |
315 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |||| |
|
|
| T |
3179456 |
atgctgtggttttggcccatgcaagtctctcttgagacctttcaggctgaaatatgcttgctgctgctaaaaaatagg |
3179533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 173 - 321
Target Start/End: Complemental strand, 3214438 - 3214290
Alignment:
| Q |
173 |
gaattttttcacaaaatctttcttcaaatctgcatcactgacataagatgtaattgtctcaagcaatgctgttgttttggcccatgcaagtctctcttga |
272 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| |||| | | ||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3214438 |
gaattttttaacaaagtctttcttcaaatcttcatcccaaatataagatgtaattgttttaagcaatgctgtggttttggcccatgcaagtctctcttga |
3214339 |
T |
 |
| Q |
273 |
gacctttcaggctcaaatatgcttgctgctgccaaaaagtaggccaata |
321 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||| |||||||||| |
|
|
| T |
3214338 |
gacctttcaggctcaaatatactttctgctgctaaaaaataggccaata |
3214290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 240 - 293
Target Start/End: Complemental strand, 37960406 - 37960353
Alignment:
| Q |
240 |
gctgttgttttggcccatgcaagtctctcttgagacctttcaggctcaaatatg |
293 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
37960406 |
gctgttgttttagcccatgcaagtctctctagagacctctcaggctcaaatatg |
37960353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0042
Description:
Target: scaffold0042; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 233 - 304
Target Start/End: Original strand, 11226 - 11297
Alignment:
| Q |
233 |
aagcaatgctgttgttttggcccatgcaagtctctcttgagacctttcaggctcaaatatgcttgctgctgc |
304 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||| || ||||| |
|
|
| T |
11226 |
aagcaaagctgttgtttttgcccatgcaagtctctctagagacctctcaggctcaaatatgctggcagctgc |
11297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0534 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold0534
Description:
Target: scaffold0534; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 234 - 304
Target Start/End: Complemental strand, 9212 - 9142
Alignment:
| Q |
234 |
agcaatgctgttgttttggcccatgcaagtctctcttgagacctttcaggctcaaatatgcttgctgctgc |
304 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||| || ||||| |
|
|
| T |
9212 |
agcaacgctgttgtttttgcccatgcaagtctctctagagacctctcaggctcaaatatgctggccgctgc |
9142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 234 - 304
Target Start/End: Complemental strand, 28049957 - 28049887
Alignment:
| Q |
234 |
agcaatgctgttgttttggcccatgcaagtctctcttgagacctttcaggctcaaatatgcttgctgctgc |
304 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||| || ||||| |
|
|
| T |
28049957 |
agcaaagctgttgtttttgcccatgcaagtctctctagagacctctcaggctcaaatatgctggccgctgc |
28049887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 234 - 304
Target Start/End: Original strand, 12634289 - 12634359
Alignment:
| Q |
234 |
agcaatgctgttgttttggcccatgcaagtctctcttgagacctttcaggctcaaatatgcttgctgctgc |
304 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| ||||||| || |||||||||||||| || ||||| |
|
|
| T |
12634289 |
agcaaagctgttgttttagcccatgcaagtctctctagagacctctcgggctcaaatatgctagccgctgc |
12634359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0599 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0599
Description:
Target: scaffold0599; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 242 - 295
Target Start/End: Complemental strand, 3364 - 3311
Alignment:
| Q |
242 |
tgttgttttggcccatgcaagtctctcttgagacctttcaggctcaaatatgct |
295 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
3364 |
tgttgtttttgcccatgcaagtctctctagagacctctcaggctcaaatatgct |
3311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 242 - 295
Target Start/End: Complemental strand, 11911670 - 11911617
Alignment:
| Q |
242 |
tgttgttttggcccatgcaagtctctcttgagacctttcaggctcaaatatgct |
295 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
11911670 |
tgttgtttttgcccatgcaagtctctctagagacctctcaggctcaaatatgct |
11911617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 234 - 304
Target Start/End: Complemental strand, 19851651 - 19851581
Alignment:
| Q |
234 |
agcaatgctgttgttttggcccatgcaagtctctcttgagacctttcaggctcaaatatgcttgctgctgc |
304 |
Q |
| |
|
||||| ||||||||||| || ||||||| ||||||| ||||||| ||||||||||||||||| || ||||| |
|
|
| T |
19851651 |
agcaaagctgttgtttttgcacatgcaattctctctagagacctctcaggctcaaatatgctggccgctgc |
19851581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 241 - 293
Target Start/End: Complemental strand, 17231228 - 17231176
Alignment:
| Q |
241 |
ctgttgttttggcccatgcaagtctctcttgagacctttcaggctcaaatatg |
293 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
17231228 |
ctgttgtttttgcccatgcaagtctctctagagacccctcaggctcaaatatg |
17231176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University