View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18521_low_28 (Length: 271)
Name: NF18521_low_28
Description: NF18521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18521_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 13348622 - 13348372
Alignment:
| Q |
18 |
actagcttgcttacttgggtcttccttgatgtcattttcttcagaaagccttctgttattggtgctgttcaaggcatgattactggtttggtttgcatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13348622 |
actagcttgcttacttgggtcttccttgatgtcattttcttcagaaagccttctgttattggtgctgttcaaggcatgattactggtttggtttgcatta |
13348523 |
T |
 |
| Q |
118 |
cccctgctgcaggtttgtaatatttcattcattcttcaagatannnnnnncccctttaaatccaatatatacgaggattattttgtacttgttttatatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13348522 |
cccctgctgcaggtttgtaatatttcattcattcttcaagatatttttttcccctttaaatccaatatttacgaggattattttgtacttgttttatatt |
13348423 |
T |
 |
| Q |
218 |
agttgatattttttcacttataactaagagcgcttggatgatatggttcat |
268 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
13348422 |
agttaatattttgtcacttataactaagagcgcttggataagatggttcat |
13348372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 42 - 118
Target Start/End: Complemental strand, 39725594 - 39725518
Alignment:
| Q |
42 |
cttgatgtcattttcttcagaaagccttctgttattggtgctgttcaaggcatgattactggtttggtttgcattac |
118 |
Q |
| |
|
||||||||||| ||||||| ||| || || |||||||| |||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
39725594 |
cttgatgtcatattcttcaaaaaaccatcagttattggagctgttcaaggcatgattactggtcttgtttgcattac |
39725518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University