View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18521_low_34 (Length: 238)
Name: NF18521_low_34
Description: NF18521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18521_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 8636928 - 8637070
Alignment:
| Q |
18 |
aaaataggcgtaaaaatttgtttctttctttcttgctggtttgattgatttggctgttattgttgtggttctagtttgttttcatttgaatgatggattg |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8636928 |
aaaataggcgtaaaaatttgtttttttctttcttgctggtttgattgatttggctgttattgttgtggttctagtttgttttcatttgaatgatggattg |
8637027 |
T |
 |
| Q |
118 |
tgaaaataatcacttttttaaacaaaataatctcttttagaag |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8637028 |
tgaaaataatcacttttttaaacaaaataatctcttttagaag |
8637070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 174 - 224
Target Start/End: Original strand, 8637053 - 8637103
Alignment:
| Q |
174 |
aataatctcttttagaagttttgaaattgatggaataggagtaaaattctg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8637053 |
aataatctcttttagaagttttgaaattgatggaataggagtaaaattctg |
8637103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 160
Target Start/End: Complemental strand, 3864737 - 3864705
Alignment:
| Q |
128 |
cacttttttaaacaaaataatctcttttagaag |
160 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
3864737 |
cacttttttaaacaaaataatcacttttagaag |
3864705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 155
Target Start/End: Original strand, 12545813 - 12545849
Alignment:
| Q |
119 |
gaaaataatcacttttttaaacaaaataatctctttt |
155 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
12545813 |
gaaaataatcactttttttaacaaaataatcactttt |
12545849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University