View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18521_low_36 (Length: 237)
Name: NF18521_low_36
Description: NF18521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18521_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 106 - 221
Target Start/End: Complemental strand, 40890835 - 40890720
Alignment:
| Q |
106 |
tattatcatcgtcattttttggtatgttggaaatttgaaatgttactatccttgaagaaacttgaatgttcctgttgttttaaaggattttttggaagac |
205 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40890835 |
tattatcatcgtcattttttggtatgtcggaaatttgaaatgttactatccttgaagaaacttgaatgttcctgttgttttaaaggattttttggaagac |
40890736 |
T |
|
| Q |
206 |
attggacggcatgttt |
221 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40890735 |
attggacggcatgttt |
40890720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 4 - 47
Target Start/End: Complemental strand, 40890880 - 40890837
Alignment:
| Q |
4 |
tggaatttataagtttcgtgatcacgaggatgatgattttgatg |
47 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40890880 |
tggaatttataagttttgtgatcacgaggatgatgattttgatg |
40890837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 133 - 209
Target Start/End: Original strand, 38286078 - 38286155
Alignment:
| Q |
133 |
tggaaatttgaaatgttactatccttgaagaaacttgaatgttcctgttgttttaaaggattttt-tggaagacattg |
209 |
Q |
| |
|
||||||||| ||||| || |||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
38286078 |
tggaaatttcaaatgctattatccttgaagaaacttggatgttaatgttgttttaaaggatttttgtggaagacattg |
38286155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University