View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18521_low_39 (Length: 228)
Name: NF18521_low_39
Description: NF18521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18521_low_39 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 28519676 - 28519901
Alignment:
| Q |
1 |
gggtagccttttaccgcagaggattcctactaaaaaatatctatgannnnnnncatattgatcaactgacatgaggctttagcaaaagtatccagaatat |
100 |
Q |
| |
|
||||||||||| |||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519676 |
gggtagccttt-accgtaggggattcctactaaaaaatatctatgatttttt-catattgatcaactgacatgaggctttagcaaaagtatccagaatac |
28519773 |
T |
|
| Q |
101 |
ctttcaaatctttgtttcagactcatttgctctaaacaaaagaaagctatgatttgcatataagagatgactaatagtgggcgctcttcggcaaacctga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519774 |
ctttcaaatctttgtttcagactcatttgctctaaataaaagaaagctatcatttgaaaataagagatgactaatagtgggcgctcttcggcaaacctga |
28519873 |
T |
|
| Q |
201 |
actccatggagaattctattttgttcag |
228 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
28519874 |
actccatggagaattctatttcgttcag |
28519901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University