View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18521_low_42 (Length: 220)
Name: NF18521_low_42
Description: NF18521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18521_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 39944225 - 39944427
Alignment:
| Q |
1 |
tcaaagctgatgagataagggccttattccttgtgaaagaagttacagaatactttcatggggatacaacaaaggaagaagctcaccctttcagaatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944225 |
tcaaagctgatgagataagggccttattccttgtgaaagaagttacagaatactttcatggggatacaacaaaggaagaagctcaccctttcagaatttt |
39944324 |
T |
 |
| Q |
101 |
tatgattgttagagacttcctaaatattttggatcaagtctgcaaagaagtgggaaggatgcaggatagaactgtgactggttcatcgagatcgttcagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39944325 |
tatgattgttagagacttcctaaatattttggatcaagtctgcaaagaagtgggaaggatgcaggatagaactgtgactggctcatcgagatcgttcagg |
39944424 |
T |
 |
| Q |
201 |
atc |
203 |
Q |
| |
|
||| |
|
|
| T |
39944425 |
atc |
39944427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 24 - 171
Target Start/End: Complemental strand, 5490221 - 5490074
Alignment:
| Q |
24 |
ttattccttgtgaaagaagttacagaatactttcatggggatacaacaaaggaagaagctcaccctttcagaatttttatgattgttagagacttcctaa |
123 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| || || ||||||||||||| |||||||| |||||||| |||||||| ||||| || |||| |
|
|
| T |
5490221 |
ttattccttgtgaaagaagttactgaatactttcatgggaatgcagcaaaggaagaagcacaccctttaagaattttcatgattgtgagagattttctaa |
5490122 |
T |
 |
| Q |
124 |
atattttggatcaagtctgcaaagaagtgggaaggatgcaggatagaa |
171 |
Q |
| |
|
| ||||||||| || ||||||||||||||||||||||| ||||||| |
|
|
| T |
5490121 |
acattttggatttggtttgcaaagaagtgggaaggatgcatgatagaa |
5490074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University