View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_high_43 (Length: 250)
Name: NF18522_high_43
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_high_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 249
Target Start/End: Complemental strand, 33166763 - 33166528
Alignment:
| Q |
14 |
ttctaaggatgcagttgtacgggggtaaatcaaagagcaaatgttttttggcaaaagaattgcagatggttataatgaacattgtggtcatttctttgca |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
33166763 |
ttctaaggatgcagttgtacaggggtaaatcaaagagcaaatgttttttggcaaaagaattgcagatggttataatgaacattgtggttatttccttgca |
33166664 |
T |
 |
| Q |
114 |
aagggcccagtacaactaaaatctcgatggtcgaaggtgaattccataattaaaaaatttggagggtgctacaagcaagcctatccaagaagnnnnnnng |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33166663 |
aagggaccagtacaactaaaatctcgatggtcgaaggtgaattccataattaaaaaatttggagggtgctacaagcaagcctatccaagaagaaaaaaag |
33166564 |
T |
 |
| Q |
214 |
tggtagcttatagtgatgtcatgggagatgcatatt |
249 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33166563 |
tggtagcttagagtgatgtcatgggagatgcatatt |
33166528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University