View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_high_8 (Length: 435)
Name: NF18522_high_8
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 9e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 311 - 430
Target Start/End: Complemental strand, 14512733 - 14512615
Alignment:
| Q |
311 |
tcttctcctaaggtccctatctcatgtctgtcctttgtgagattttgttgcccgaatgattatctttaatctaatcatttgattgatatttttgtttctc |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||| ||| || ||||| |
|
|
| T |
14512733 |
tcttctcctaaggtccctatctcatgtctgtcctttgtgagattttgttgcccgactgattatctttaatctaatcgtttgtttgatctttctg-ttctc |
14512635 |
T |
|
| Q |
411 |
ttttccagcattcatctcac |
430 |
Q |
| |
|
|||||||| |||||| |||| |
|
|
| T |
14512634 |
ttttccagtattcatttcac |
14512615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 309 - 386
Target Start/End: Original strand, 17451613 - 17451691
Alignment:
| Q |
309 |
tttcttctcctaaggtcccta--tctcatgtctgtcctttgtgagattttgttgcccgaatgattatctttaatctaatc |
386 |
Q |
| |
|
||||||||||||||||||||| |||| ||| |||||||||||||||||||||| |||| |||||||| ||||||||||| |
|
|
| T |
17451613 |
tttcttctcctaaggtccctatctctcttgtttgtcctttgtgagattttgttg-ccgattgattatccttaatctaatc |
17451691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 154 - 212
Target Start/End: Original strand, 4288952 - 4289011
Alignment:
| Q |
154 |
cttagatcacttggtgct-ggattctcttctcaaccttgtagtccttggtttcagacttg |
212 |
Q |
| |
|
||||||||||||||| | |||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
4288952 |
cttagatcacttggttgtaggattctcttttcaaccttgtagtccttggtttgagacttg |
4289011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 154 - 203
Target Start/End: Complemental strand, 636456 - 636406
Alignment:
| Q |
154 |
cttagatcacttggt-gctggattctcttctcaaccttgtagtccttggtt |
203 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
636456 |
cttagatcacttggttgctggattctctcctcaatcttgtggtccttggtt |
636406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 38713352 - 38713428
Alignment:
| Q |
150 |
ttttcttagatcacttggt-gctggattctcttctcaaccttgtagtccttggtttcagacttgacgtcttaaaaaa |
225 |
Q |
| |
|
|||||||| |||||||| | || ||||||| | |||| |||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
38713352 |
ttttcttaaatcacttgattgcaggattctttcttcaatcttgtagtccttcatttcagacttggcgtcttaaaaaa |
38713428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University