View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_low_12 (Length: 417)
Name: NF18522_low_12
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_low_12 |
 | |
|
| [»] scaffold0020 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 5e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 24 - 163
Target Start/End: Complemental strand, 37126257 - 37126118
Alignment:
| Q |
24 |
tgagatcaaaatcaaagattcgaaagttagctagttgctagtgtaaccaccagagctcacacatcaatattaccaaagcaccaaatgggaaaatccattt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37126257 |
tgagatcaaaatcaaagattcgaaagttagctagtagttagtgtaaccaccaaagctcacacatcaatattaccaaagcaccaaatgggaaaatccattt |
37126158 |
T |
|
| Q |
124 |
tactttaaaaacaaagcattttagagtttcataatgtaag |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37126157 |
tactttaaaaacaaagcattttagagtttcataatgtaag |
37126118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 363 - 401
Target Start/End: Complemental strand, 37125975 - 37125937
Alignment:
| Q |
363 |
ccccattccactttctaattatgtcagccatcaaagatt |
401 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37125975 |
ccccattccactttctaattaagtcagccatcaaagatt |
37125937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 162 - 205
Target Start/End: Complemental strand, 20066699 - 20066656
Alignment:
| Q |
162 |
agagtctcaaatttgatgatatatgacttgaaaatgtgtttata |
205 |
Q |
| |
|
||||||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
20066699 |
agagtctcacatttgatgatatatgactttaatatgtgtttata |
20066656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 161 - 203
Target Start/End: Complemental strand, 5723552 - 5723510
Alignment:
| Q |
161 |
aagagtctcaaatttgatgatatatgacttgaaaatgtgttta |
203 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||| |||| |
|
|
| T |
5723552 |
aagagtctcaaatttgatgaaatatgatttgaaaatgttttta |
5723510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 205
Target Start/End: Complemental strand, 158282 - 158237
Alignment:
| Q |
160 |
taagagtctcaaatttgatgatatatgacttgaaaatgtgtttata |
205 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||| ||||||| |
|
|
| T |
158282 |
taagagtctcacatttgatgaaatatgacttgtaaatgagtttata |
158237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 205
Target Start/End: Complemental strand, 47185750 - 47185709
Alignment:
| Q |
164 |
agtctcaaatttgatgatatatgacttgaaaatgtgtttata |
205 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
47185750 |
agtctcatatttgatgagatatgacttgacaatgtgtttata |
47185709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University