View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_low_29 (Length: 343)
Name: NF18522_low_29
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 17 - 338
Target Start/End: Original strand, 308304 - 308625
Alignment:
| Q |
17 |
acgtctttatacaaatcacgttgccacttctcagtttgagttttactaggaagatatccttaccttccaacaaatttatctcttcccatggaattgtcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
308304 |
acgtctttatacaaatcacgttgccacttctcagtttgagttttactaggaagatatccttaccttccaacaaatttatctcttcccatggaattgtcat |
308403 |
T |
|
| Q |
117 |
tgccagcattgcccctatgcctttctcttgacgcaaaacctgactctcccagtttttatccttgtagggtgctttgtcatctgcaaattgcttctcaggt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
308404 |
tgccagcattgcccctatgcctttctcttgacgcaaaacctgactctcccagtttttatccttgtagggtgctttgtcatctgcaaattgcttctcaggt |
308503 |
T |
|
| Q |
217 |
ctgtccaaatggtatggattgctgcttctttcctccttcctttctgtcctttctggacgatggttaaactggccttttgcagctagattaacttctcctg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
308504 |
ctgtccaaatggtatggattgctgcttctttcctccttcctttctgtcctttctggacgatggttaaactggccttttgcagctagattaacgtctcctg |
308603 |
T |
|
| Q |
317 |
aatccaccggagccttcatctc |
338 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
308604 |
aatccaccggagccttcttctc |
308625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 191 - 273
Target Start/End: Complemental strand, 48117101 - 48117019
Alignment:
| Q |
191 |
tgtcatctgcaaattgcttctcaggtctgtccaaatggtatggattgctgcttctttcctccttcctttctgtcctttctgga |
273 |
Q |
| |
|
|||| ||||||| | ||||||||||||| || | ||||| || |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48117101 |
tgtcctctgcaattcgcttctcaggtctatctagatggttagggttgctgcttctttcctccttcctttcattcctttctgga |
48117019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University