View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_low_35 (Length: 319)
Name: NF18522_low_35
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_low_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 8029288 - 8028988
Alignment:
| Q |
1 |
agccattgaaggctgtaagaggaatgaatgaaatgcattgtttttgttggaaaaattctgccataaaaagaaccaggagccccatagaaaaagattggac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8029288 |
agccattgaaggctgtaagaggaatgaatgaaatgcattgtttttgttggaaaaatcctgccataaaaagaaccaggagccccatagaaaaagattggac |
8029189 |
T |
 |
| Q |
101 |
caccaatcccatcttccacttcatcatttagtttctctgtgaacctatcaagtaacctaaaaatattgttgaaatcattcccttgaagatcattcatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8029188 |
caccaatcccatcttccacttcatcatttagtttctctgtgaacctatcaagtaacctaaaaatgttgttgaaatcattcccttgaagatcattcatgaa |
8029089 |
T |
 |
| Q |
201 |
gacttggtattctggagactcgtgattatgttcttggcaaagtttctttactaatttgataacttcagatatcacaaacaaagtgtttggcccagaagaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8029088 |
gacttggtattctggagactcgtgattatgttcttggcaaagtttatcaactaatttgataacttcagatatcaccaacaaagtgtttggcccagaagaa |
8028989 |
T |
 |
| Q |
301 |
c |
301 |
Q |
| |
|
| |
|
|
| T |
8028988 |
c |
8028988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 48 - 89
Target Start/End: Original strand, 27736710 - 27736751
Alignment:
| Q |
48 |
tggaaaaattctgccataaaaagaaccaggagccccatagaa |
89 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | |||||||| |
|
|
| T |
27736710 |
tggaaaaattctgccataaaatgaaccaggaactccatagaa |
27736751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University