View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_low_52 (Length: 257)
Name: NF18522_low_52
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_low_52 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 10 - 241
Target Start/End: Original strand, 6640079 - 6640308
Alignment:
| Q |
10 |
aatattccttagctttaatggttctatgacccaacttttgtcattgttcgaattatattgttgtttgtatacttgtactatattttggtgtgaaaaacat |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6640079 |
aatattccttagcttgaatggttctatgacc----ttttgtcattgttctaactatattgttgtttggatacttgtactatattttggtgtgaaaaacat |
6640174 |
T |
|
| Q |
110 |
gcttcttattaattttataacatattattgctctccaattttctaggttgatacaa--gatatgaatattcaaacgaaggtatcacaaacctttagaacc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6640175 |
gcttcttattaattttataacatattattgctctccaattttctaggttgatacaactgatatgaatattcaaacgaaggaatcacaaacctttagaacc |
6640274 |
T |
|
| Q |
208 |
aataaatttttatttaatacttcaatgctgtcat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6640275 |
aataaatttttatttaatacttcaatgctgtcat |
6640308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 183 - 231
Target Start/End: Original strand, 15129701 - 15129749
Alignment:
| Q |
183 |
gaaggtatcacaaacctttagaaccaataaatttttatttaatacttca |
231 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15129701 |
gaaggtatcacatacctttagaaccaataaatttttatttagtacttca |
15129749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University