View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_low_53 (Length: 251)
Name: NF18522_low_53
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 3 - 241
Target Start/End: Complemental strand, 30789550 - 30789310
Alignment:
| Q |
3 |
taatttatcttctaacaattacttttgtgatctttnnnnnnnnn--ggataatattttaattaagaccaagtatataagaaggaagtttactaaagattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30789550 |
taatttatcttctaacaattacttttgtgatcttttaaaaaaaaaaggataatatttttattaagaccaagtatataagaaagaagtttactaaagattg |
30789451 |
T |
 |
| Q |
101 |
ttcattggctcaaccatgnnnnnnngcctcactcacttattaattgtcttatgatgaaggactgcaaattacaattactcgtatttatagagagacaaac |
200 |
Q |
| |
|
||||| |||||||||||| | |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30789450 |
ttcatcggctcaaccatgtttttttgactcactcacttattaattgtcttatgatgaaggactacaaattacaattactcatatttatagagagacaaac |
30789351 |
T |
 |
| Q |
201 |
gagatagttgacttgaacgttgtgcccatcatatacctatg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30789350 |
gagatagttgacttgaacgttgtgcccatcatatacgtatg |
30789310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University