View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_low_60 (Length: 243)
Name: NF18522_low_60
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_low_60 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 232
Target Start/End: Original strand, 41260884 - 41261096
Alignment:
| Q |
20 |
ggcacccggtgtggcctttatgtttgcagtatctcaatcatcaaagccttgtcatcatcatgaatttgtgaggattccttttgattctccgacggagatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41260884 |
ggcacccggtgtggcctttatgtttgcagtatctcaatcatcaaagccttgtcatcatcatgaatttgtgaggattccttttgattctccgacggagatg |
41260983 |
T |
 |
| Q |
120 |
gtttgcttgccggaacatgtggtggttagcacctcccactttgatttcttcttgcccacgttgtttgctgctttggttgtttttacttcaacttgcttgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41260984 |
gtttgcttgccggaacatgtggtggttagcacctcccactttgatttcttcttgcccacgttgtttgctgctttggttgtttttacttcaacttgcttgc |
41261083 |
T |
 |
| Q |
220 |
ttcgttctgtgct |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41261084 |
ttcgttctgtgct |
41261096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University