View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_low_61 (Length: 240)
Name: NF18522_low_61
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_low_61 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 1273861 - 1273723
Alignment:
| Q |
1 |
tttcaccaaaatatatgaaatgaaggaagtatgattagagagtatttttgtaaatttattttttattatgtagtcatctctagtgattagatctaataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1273861 |
tttcaccaaaatatatgaaatgaaggaagtatgattagagggtatttttgtaaatttattttttattatgcagtcatctctagtgattagatctaataaa |
1273762 |
T |
 |
| Q |
101 |
taatcacgtgtaaatttatatagacaatcaaacatcttg |
139 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
1273761 |
taatcacctctaaatttatacggacaatcaaacatcttg |
1273723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University