View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_low_65 (Length: 232)
Name: NF18522_low_65
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_low_65 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 61 - 218
Target Start/End: Complemental strand, 49628806 - 49628645
Alignment:
| Q |
61 |
atttacacgcctaacattgatttaattaggttgctaggaggattgtagacattttacattccgtgat----atcattaggagcatcttcaacgagagatg |
156 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49628806 |
atttacacgccgaacattgatttaattaggttgctaggaggattgtagacattttacattccgtgatcttgatcattaggagcatcttcaacgagagatg |
49628707 |
T |
|
| Q |
157 |
ttttgtctaatagcatgtagaataaataagaagggttgctattgagatgcaagacttgtata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49628706 |
ttttgtctaatagcatgtagaataaataagaagggttgctattgagatgcaagacttgtata |
49628645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 219
Target Start/End: Complemental strand, 27908372 - 27908330
Alignment:
| Q |
177 |
aataaataagaagggttgctattgagatgcaagacttgtatat |
219 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| ||||||||| |
|
|
| T |
27908372 |
aataaataagaaggattgctattaagatgcaaggcttgtatat |
27908330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 216
Target Start/End: Complemental strand, 20545956 - 20545915
Alignment:
| Q |
175 |
agaataaataagaagggttgctattgagatgcaagacttgta |
216 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
20545956 |
agaagaaataagaaggattgctattgagatgcaaggcttgta |
20545915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University