View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_low_70 (Length: 221)
Name: NF18522_low_70
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_low_70 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 215
Target Start/End: Original strand, 36219837 - 36220037
Alignment:
| Q |
19 |
ctatagctcctggattattattttgttggttgtcgttattattagaaatataaccaggaaaatctttctgatgaggatgatgttgatggcttagacagag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36219837 |
ctatagctcctggattattattttgttggttgtcgttattattagaaatataaccaggaaaatctttctgatgaggatgatgttgatggcttagacagag |
36219936 |
T |
|
| Q |
119 |
gttgtgttgtgacatgcac----tatgtactagaatcttgtttgagagtataaacgtatgtttgagtgtttgcaacgtgaaaccaaacaactgatgatgt |
214 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
36219937 |
gttgtgttgtgacatacactatgtatgtactagaatcttgtttgagagtataaacgtatgtttgagtgtttgcaacgtgaaaccaaacaaccgataatgt |
36220036 |
T |
|
| Q |
215 |
c |
215 |
Q |
| |
|
| |
|
|
| T |
36220037 |
c |
36220037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University