View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_low_71 (Length: 213)
Name: NF18522_low_71
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_low_71 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 5 - 194
Target Start/End: Original strand, 33570819 - 33571009
Alignment:
| Q |
5 |
tttctttcattcttataatctcaagctaaaacagaaagttgcagcaagtcttgtatttctgt-ctatgtatgtaactgtgattgatttgttacggtgact |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33570819 |
tttctttcattcttataatctcaagctaaaacaaaaagttgcagcaagttttgtatttctgtgctatgtatgtaactgtgattgatttgttacggtgact |
33570918 |
T |
 |
| Q |
104 |
gctcttggaactttctatatcttccaaacagtatatatttttcaccccaatttttccccaagtttctaagatattaaacgtatttgcgaac |
194 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33570919 |
gctcttggcactttctatatcttccaaacagtatatatttttcaccccaattttttcccaagtttctaagatattaaacgtatttgcgaac |
33571009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University