View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18522_low_73 (Length: 207)
Name: NF18522_low_73
Description: NF18522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18522_low_73 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 44 - 191
Target Start/End: Original strand, 6534043 - 6534189
Alignment:
| Q |
44 |
tatatatgacatgatttgattgaaaatgtatcattattgccattgctatcgatgtaaattttttactaaaaattacaaattaaagtatgctatgataatg |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6534043 |
tatatatgacatgatttgattgaaaatgtatcattattgccatcgctatcgatgtaaattttttactaaaaattacaaattaaagtatgctacgataatg |
6534142 |
T |
|
| Q |
144 |
aatacataaaaagagtgaaacttcattttgactc-gtcacaattttcat |
191 |
Q |
| |
|
|||||||||||||||||||| | || ||||||| |||||||||||||| |
|
|
| T |
6534143 |
aatacataaaaagagtgaaaatcca--ttgactcggtcacaattttcat |
6534189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University