View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18523_low_6 (Length: 311)
Name: NF18523_low_6
Description: NF18523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18523_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 8e-58; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 26 - 219
Target Start/End: Original strand, 8540506 - 8540697
Alignment:
| Q |
26 |
tgtatactagtagaattcaaggttacatagaccactttttgataaagaaaatgtcaaaattaaatgagtattgtgtaaatgaagaatcgtacttctcaca |
125 |
Q |
| |
|
||||||||||||||| || |||||| |||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8540506 |
tgtatactagtagaactctaggttatatagac-actttttgataaagaaaatgccaaaattaaatgagtattgtgtaaatgaagaatcatacttctcaca |
8540604 |
T |
|
| Q |
126 |
tattagtagaggataggcagagattaggtgagataagagaagagaaaatgagattttgattttgtgtttgttttgtagtgagcataacaaaaca |
219 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||| |||||||||||||| |||| ||||||||||| ||| ||| |||| |||||| |
|
|
| T |
8540605 |
tattagtagaggagaggcagagattaggtgagaacagagatacgaaaatgagatttt-atttagtgtttgttttatagcgagaataaaaaaaca |
8540697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 128 - 265
Target Start/End: Original strand, 8569384 - 8569514
Alignment:
| Q |
128 |
ttagtagaggataggcagagattaggtgagataagagaagagaaaatgagattttgattttgtgtttgttttgtagtgagcataacaaaacaaaattgat |
227 |
Q |
| |
|
|||||||| || ||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||| ||||| |||||||||||| |
|
|
| T |
8569384 |
ttagtagaagagaggcagagattaggtgagaatggagaaga--aaatgagattttgattttttgtttgttttgtagcaagcat-----aacaaaattgat |
8569476 |
T |
|
| Q |
228 |
atgtatgattattaatttttgggtaatgtgagtgagac |
265 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||| |
|
|
| T |
8569477 |
atgtatgattttttttttttgggtaatgtgagtgagac |
8569514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 52 - 99
Target Start/End: Original strand, 8588682 - 8588729
Alignment:
| Q |
52 |
atagaccactttttgataaagaaaatgtcaaaattaaatgagtattgt |
99 |
Q |
| |
|
|||| |||||||||||| ||||||||| |||||||||| ||||||||| |
|
|
| T |
8588682 |
atagtccactttttgatgaagaaaatgccaaaattaaacgagtattgt |
8588729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University