View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18523_low_8 (Length: 265)
Name: NF18523_low_8
Description: NF18523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18523_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 41721380 - 41721625
Alignment:
| Q |
1 |
atttcataatagtaactggcaaaataatagaatatcaatttcttcttttgacatatacaactcaatgctccacccagtactcgttgtcaaaacaaaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41721380 |
atttcataatagtaactggcaaaataatagaatatcaatttcttcttttgacatatacaactcaatgctccacccagtactcgttgtcaaaacaaaacaa |
41721479 |
T |
|
| Q |
101 |
aaactgtccataaccacttttttcatttatctttagctatgtcatcttataaaaataccattcaaatcatttaaagcgagagaagtacattgtaaaatac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41721480 |
aaactgtccataaccacttttttcatttatctttagctatgtcatcttataaaaataccattcaaatcatttaaagcgagagaagtacattgtaaaataa |
41721579 |
T |
|
| Q |
201 |
atattgtccattgaatcccnnnnnnnttccatcgtcaagtctaaaa |
246 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41721580 |
atattgtccattgaatcccaaaaaaattccatcgtcaagtctaaaa |
41721625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University