View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18525_low_5 (Length: 292)
Name: NF18525_low_5
Description: NF18525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18525_low_5 |
 | |
|
| [»] scaffold0272 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0272 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 43 - 239
Target Start/End: Complemental strand, 7462 - 7263
Alignment:
| Q |
43 |
tggcattggattcacttatgtctttgatcttt--ctttctttcaaatatgttgtttatctctttctttttccaaagcaccaggaccttacagtccaattt |
140 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| |||||||| |||| | |||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
7462 |
tggcattggattcacttgtgtctttgatatttttctttcttttaaatcttttgtttatctctttctttttccaaagcaccagaacctaacagtccaattt |
7363 |
T |
|
| Q |
141 |
tgagaccaactcctattagtg-cagttcactagtaacaattacataagaacactcaataaatgtcctcaaaccgatgggcaaagtgaggtcctcaataaa |
239 |
Q |
| |
|
| ||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
7362 |
ttagaccaattcctattagtgtcagttcactagtaacaattgcataagaacactcaataaatgtcctcaaacctatgggaaaagtgaggtcctcaataaa |
7263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University