View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18525_low_6 (Length: 237)
Name: NF18525_low_6
Description: NF18525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18525_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 40549656 - 40549868
Alignment:
| Q |
13 |
aatatgacctttactacattgctcatgtggctacatcaaataaaggcacagcatgttcccttaaactctgcacatttgggggccagcaaaataaaactga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40549656 |
aatatgacctttactacattgctcatgtggctacatcaaataaaggcacagcatgttcccttaaactctgcacatttgggggccagcaaaataaaactga |
40549755 |
T |
 |
| Q |
113 |
tgacccatcactcgatctccacattacattactcttcacatcatcccaacttttgaaaatacccttccaaaagttatatcctgcttgtgcattctaggaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40549756 |
tgacccatcactcgatctccacattacattactcttcacatcatcccaacttttgaaaatacccttccaaaagttatatcctgcttgtgcattctaggaa |
40549855 |
T |
 |
| Q |
213 |
ggatgtcattact |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40549856 |
ggatgtcattact |
40549868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University