View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18525_low_7 (Length: 219)
Name: NF18525_low_7
Description: NF18525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18525_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 20135946 - 20135743
Alignment:
| Q |
1 |
tgtagtattttttagcgctacatgaacatcagctgctgcagaattttttggcgcttcaggttccaaaaatttactaacagaaatatcagttgctgctgnn |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20135946 |
tgtagtattttttagcactacatgaacatcagctgctgcagaattttttggcgcttcaggttccaaaaatttactaacagaaatatcagttgctgctgtt |
20135847 |
T |
 |
| Q |
101 |
nnnnnnatggctaccggttccaaaacag-ttttttgaaacagctgattgcgttgatgagacacactgtccccgtgtccttccagatcagtagtatgtttc |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20135846 |
ttttttatggctaccggttccaaaacagtttttttgaaacagctgattgcattgatgagacacactgtccccgtgtccttccagatcagtagtatgtttc |
20135747 |
T |
 |
| Q |
200 |
gttg |
203 |
Q |
| |
|
|||| |
|
|
| T |
20135746 |
gttg |
20135743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 4 - 96
Target Start/End: Complemental strand, 20136093 - 20136001
Alignment:
| Q |
4 |
agtattttttagcgctacatgaacatcagctgctgcagaattttttggcgcttcaggttccaaaaatttactaacagaaatatcagttgctgc |
96 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| ||| ||||||| ||| | ||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
20136093 |
agtattttttagtgctacatgaacctcagctgctccagtattttttagcgttacaggttccaaaaatttactaacagaaacatcagctgctgc |
20136001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 44356125 - 44356328
Alignment:
| Q |
1 |
tgtagtattttttagcgctacatgaacatcagctgctgcagaattttttggcgcttcaggttccaaaaatttactaacagaaatatcagttgctgctgnn |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44356125 |
tgtagtattttttagcactacatgaacatcagctgctgcagaattttttggcgcttcaggttccaaaaatttactaacagaaatatcagttgctgctgtt |
44356224 |
T |
 |
| Q |
101 |
nnnnnnatggctaccggttccaaaacag-ttttttgaaacagctgattgcgttgatgagacacactgtccccgtgtccttccagatcagtagtatgtttc |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44356225 |
ttttttatggctaccggttccaaaacagtttttttgaaacagctgattgcattgatgagacacactgtccccgtgtccttccagatcagtagtatgtttc |
44356324 |
T |
 |
| Q |
200 |
gttg |
203 |
Q |
| |
|
|||| |
|
|
| T |
44356325 |
gttg |
44356328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 4 - 96
Target Start/End: Original strand, 44355978 - 44356070
Alignment:
| Q |
4 |
agtattttttagcgctacatgaacatcagctgctgcagaattttttggcgcttcaggttccaaaaatttactaacagaaatatcagttgctgc |
96 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| ||| ||||||| ||| | ||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
44355978 |
agtattttttagtgctacatgaacctcagctgctccagtattttttagcgttacaggttccaaaaatttactaacagaaacatcagctgctgc |
44356070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University