View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18525_low_8 (Length: 214)
Name: NF18525_low_8
Description: NF18525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18525_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 4822109 - 4821924
Alignment:
| Q |
18 |
aggttgtgacttgagattgagatgatgcaannnnnnnggggcatgtaaggcagctgcagcttttgaaggtggtcctggcaggggcacaagcagctgccga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4822109 |
aggttgtgacttgagattgagatgatgcaatttttttggggcatgtaaggcagctgctgcttttgaaggtggtcctggaaggggcacaagcagctgccga |
4822010 |
T |
|
| Q |
118 |
tggcgggggtcgcgacgatggaagtattggataatacaatggtggtgctgattgcaggctgcaaagcttctttttcttcttctcac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
4822009 |
tggcgggggtcgcgacgatggaagtattggataatacaatggtggtgctgattgcaggctgcaaagcttcattttcttcttatcac |
4821924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 4812010 - 4811942
Alignment:
| Q |
135 |
atggaagtattggataatacaatggtggtgctgattgcaggctgcaaagcttctttttcttcttctcac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4812010 |
atggaagtattggataatacaatggtggtgctgattgcaggctgcaaagcttctttttcttcttatcac |
4811942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University