View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18525_low_8 (Length: 214)

Name: NF18525_low_8
Description: NF18525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18525_low_8
NF18525_low_8
[»] chr6 (2 HSPs)
chr6 (18-203)||(4821924-4822109)
chr6 (135-203)||(4811942-4812010)


Alignment Details
Target: chr6 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 4822109 - 4821924
Alignment:
18 aggttgtgacttgagattgagatgatgcaannnnnnnggggcatgtaaggcagctgcagcttttgaaggtggtcctggcaggggcacaagcagctgccga 117  Q
    ||||||||||||||||||||||||||||||       |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||    
4822109 aggttgtgacttgagattgagatgatgcaatttttttggggcatgtaaggcagctgctgcttttgaaggtggtcctggaaggggcacaagcagctgccga 4822010  T
118 tggcgggggtcgcgacgatggaagtattggataatacaatggtggtgctgattgcaggctgcaaagcttctttttcttcttctcac 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||    
4822009 tggcgggggtcgcgacgatggaagtattggataatacaatggtggtgctgattgcaggctgcaaagcttcattttcttcttatcac 4821924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 4812010 - 4811942
Alignment:
135 atggaagtattggataatacaatggtggtgctgattgcaggctgcaaagcttctttttcttcttctcac 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
4812010 atggaagtattggataatacaatggtggtgctgattgcaggctgcaaagcttctttttcttcttatcac 4811942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University