View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18526_high_19 (Length: 241)
Name: NF18526_high_19
Description: NF18526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18526_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 3 - 218
Target Start/End: Complemental strand, 53032165 - 53031948
Alignment:
| Q |
3 |
gaaaagaaagcggaacaaggaagcaaagagtcagcaatcactttgaaatcccaatatccaaaagtgaataacaatttgtgtcattgcttatccctcttta |
102 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53032165 |
gaaaagaaagcagaacaaggaagcaaagagtcagcaatcactttgaaatcccaatatccaaaagtgaataacaatttgtgtcattgcttatccctcttta |
53032066 |
T |
 |
| Q |
103 |
tagtatctctagttttgctttctactatttctaaatttaatttaataatgagagagatattatatatccatcttattcatttcatcatcttctctct--c |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
53032065 |
tagtatctctagttttactttctactatttctaaatttaatttaataatgagagagatgttatatatccatcttattcatttcatcatcttctctctctc |
53031966 |
T |
 |
| Q |
201 |
tctatcacaatatcatct |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
53031965 |
tctatcacaatatcatct |
53031948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University