View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18526_low_14 (Length: 287)
Name: NF18526_low_14
Description: NF18526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18526_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 181 - 260
Target Start/End: Complemental strand, 50592714 - 50592635
Alignment:
| Q |
181 |
gcacaatacatcaagattaaccactacactgttgggctgcaattttgaaagacgttgctgtgtcacaaactcgcatgcac |
260 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50592714 |
gcacaatacatcaagattaaccgctacactgttgtgctgcaattttgaaagacgttgctgtgtcacaaactcgcatgcac |
50592635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 71 - 112
Target Start/End: Complemental strand, 3285310 - 3285269
Alignment:
| Q |
71 |
cccctaacaaattaacaaataataacatctgtctataaaaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
3285310 |
cccctaacaaattaacaaataatagcatttgtctataaaaaa |
3285269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University