View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18526_low_19 (Length: 249)
Name: NF18526_low_19
Description: NF18526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18526_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 56 - 238
Target Start/End: Original strand, 14002866 - 14003050
Alignment:
| Q |
56 |
tttaaagatttgatcttaaagtttgnnnnnnnaattgcaagagggcttaacgcccccttaaatttcgtttttaaagattaatactaattatgaggtgcat |
155 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14002866 |
tttaaagatttgatcttaaagtttgtttttt-aattacaagagggcttaacaccctcttaaatttcgtttttaaagattaatactaattatgaggtgcat |
14002964 |
T |
 |
| Q |
156 |
cttgctaagtaaaatatattaaattaagcttacctcacatgttacaatttttcaacgt---ggaaaaatggaatatgtaatgtctc |
238 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
14002965 |
gttgctaagtaaaatatattaaaataagcttacctcacatgttaccatttttcaacgtgtggaaaaaatggaatatgtaatgtctc |
14003050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University