View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18526_low_27 (Length: 237)
Name: NF18526_low_27
Description: NF18526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18526_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 14002374 - 14002235
Alignment:
| Q |
55 |
gtaaacaattctattcctgactttatgcttctgaaagccttctcagtcaaaattaattacggtaaagctccaacaattaaagagataatgtggcagccat |
154 |
Q |
| |
|
|||||||||| |||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14002374 |
gtaaacaattatattgctgaccttatgcttctcaaagccttctcagtcaaaattaattacggtaaagctccaacaattaaagatataatgtggcagccat |
14002275 |
T |
|
| Q |
155 |
tagtgttcaactggattaaatgcaatattgatggagcctt |
194 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14002274 |
tagtgttcaactagattaaatgcaatattgatggagcctt |
14002235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 14002537 - 14002482
Alignment:
| Q |
1 |
tttagtacattataacattctctcttgtaacagtttaaatatcaatatcatctggt |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14002537 |
tttagtacattataacattctctcttgtaaaagtttaaatatcaatatcatctggt |
14002482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 221
Target Start/End: Complemental strand, 14002164 - 14002136
Alignment:
| Q |
193 |
tttgcatacaatttaggcaacacaaaatc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14002164 |
tttgcatacaatttaggcaacacaaaatc |
14002136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University