View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18526_low_30 (Length: 230)
Name: NF18526_low_30
Description: NF18526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18526_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 14 - 211
Target Start/End: Original strand, 2081157 - 2081355
Alignment:
| Q |
14 |
tcatcatgtgtgacttttcgtttgcttttagacataaagagtgtaggtggttatgagttgtggttgtcatgttaggtaatcggtaacatcttttttagtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2081157 |
tcatcatgtgtgacttttcgtttgcttttagatataaagagtgtgggtggttatgagttgtggttgtcatgttaggtaatcggtaacatcttttttagtg |
2081256 |
T |
 |
| Q |
114 |
tttctctccttggggactatatggatttgacatttagtgtttgggatatttgagacct-aagaaacaactgttgtttctccagtattggtggagcacat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2081257 |
tttctctccttggggactatatggatttgacatttagtgtttgggatatttgagacctaaagaaacaactgttgtttctccagtattggtggagcacat |
2081355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University