View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18526_low_7 (Length: 400)
Name: NF18526_low_7
Description: NF18526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18526_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 18 - 374
Target Start/End: Complemental strand, 1671632 - 1671276
Alignment:
| Q |
18 |
gatttgagtcacaaagcttattgtgttaaattttggtgcagaaaggaaagtcattttgcttaaagcaatgcgccatatctttagcgcttgcggtcgggtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1671632 |
gatttgagtcacaaagcttattgtgttaaattttggtgcagaaaggaaagtcattttgcttaaagcaatgcgcgatatctttagcgcttgcggtcgggtt |
1671533 |
T |
|
| Q |
118 |
aataacaggagttcctacgttggggttgcctaacgatgcacatgcagctaaccccgtgttacctgatctgtctgtattgatatctggaccgccaattaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1671532 |
aataacaggagttcctacgttggggttgcctaacgatgcacatgcagctaaccccgtgttacctgatctgtctgtattgatatctggaccaccaattaag |
1671433 |
T |
|
| Q |
218 |
gaccctggggcattgttgagatatggtcttcctattgacaataaggcgattagagaagtgcaaaaaccacttgaagatattactgatagtctcaagattt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1671432 |
gaccctggggcattgttgagatatggtcttcctattgacaataaggcgattagagaagtgcaaaaaccacttgaagatattactgatagtctcaagattt |
1671333 |
T |
|
| Q |
318 |
ctggagtcaaggcactcgactctgtcgaaagagtaagattcttattctgttgtccaa |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1671332 |
ctggagtcaaggcactcgactctgtcgaaagagtaagattcttattctgttgtccaa |
1671276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University