View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18527_high_28 (Length: 255)
Name: NF18527_high_28
Description: NF18527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18527_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 25 - 162
Target Start/End: Complemental strand, 31810615 - 31810478
Alignment:
| Q |
25 |
taatggataaaaccaaaacacttgatgtaagattgcaaacaaagactaagaagttggacaacaacaaaactacacaaattaagggctgtgaagggtgaag |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31810615 |
taatggataaaaccaaaacacttgatgtaagattgcaaacaaagactaagaagttggacaacaacaaaactacacaaattaagggctgtgaagggtgaag |
31810516 |
T |
 |
| Q |
125 |
aaagagcataacacaagggtatgaaaggtttgacaata |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31810515 |
aaagagcataacacaagggtatgaaaggtttgacaata |
31810478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 163 - 255
Target Start/End: Complemental strand, 31810331 - 31810239
Alignment:
| Q |
163 |
gtatgtcccaacccacttgaacacctgtaaagaccgacacagaaatttatgctctcacgtccaagcattttgtagtgcgtgtagcaggatacc |
255 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31810331 |
gtatgtcccaacccacttgaacacccgtaaagaccgacacagaaatttatgctctcacgtccaagcattttgtagtgcgtgtagcaggatacc |
31810239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University