View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18527_high_29 (Length: 249)
Name: NF18527_high_29
Description: NF18527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18527_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 231
Target Start/End: Complemental strand, 43541018 - 43540798
Alignment:
| Q |
11 |
aaaattaaatagtcttctacaatcttaatatcctaagtttacatatgatattgtggtttgcaagctaaatctacttcctcataactgaaagttaattttt |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
43541018 |
aaaaataaatagtcttctacaatcttaatatcctaagtttacatatgatattgtggtttgcaagctatatctacttccacataactgaaagttaattttt |
43540919 |
T |
 |
| Q |
111 |
ggtttcaaaagcttctctcgttcaacaaattaatcagcttgctccatggacaattgacaattcaaacttctctaattaaggatacaaatttaggcacatc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540918 |
ggtttcaaaagcttctctcgttcaacaaattaatcagcttgctccatggacaattgacaattcaaacttctctaattaaggatacaaatttaggcacatc |
43540819 |
T |
 |
| Q |
211 |
attactagttaactatttatc |
231 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43540818 |
attactagttaactatttatc |
43540798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University