View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18527_high_39 (Length: 223)
Name: NF18527_high_39
Description: NF18527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18527_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 17 - 207
Target Start/End: Original strand, 19582890 - 19583080
Alignment:
| Q |
17 |
atatcatccacttgtggtggagctttattttatttaaaatcatagattagtccattgaaattaacaccagataaatataatctaagatcttgtgaggagt |
116 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19582890 |
atatcattcatttgtggtggagctttattttatttaaaattatagattagtccattgaaattaacaccagatgaatataatctaagatcttgtgaggagt |
19582989 |
T |
 |
| Q |
117 |
acattctaggatcccaagtcaacaacataagataaacttaagtgaagttttgtctttcatgatagtgttcgtagaatttataaattattat |
207 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19582990 |
acattctaagatcccaagtcaacaacataagacaaactcaaatgaagttttgtctttcatgatagtgtttgtagaatttataaattattat |
19583080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University