View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18527_low_17 (Length: 374)
Name: NF18527_low_17
Description: NF18527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18527_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 34583485 - 34583663
Alignment:
| Q |
1 |
gcaccagaatcctacccgcttcatttctgggcatacttctagagaaaattgtttagtcataaatgttgatggtagttgtagcggtcattctggccatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34583485 |
gcaccagaatcctacccgcttcatttctgggcatccttctagagaaagttgtttagtcataaatgttgatggtagttgtagcggtcattctggccatgct |
34583584 |
T |
|
| Q |
101 |
ggagct-ggggtctgattaggcgtggtgatggcagctgggttgtcgagttcagcagttacctaggactttccaataaca |
178 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34583585 |
ggagctgggggtctgattaggcgtggtgatggcagctgggttgtcgggttcagcagttacctaggactttccaataaca |
34583663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 196 - 318
Target Start/End: Original strand, 34583875 - 34583997
Alignment:
| Q |
196 |
gctagtgtggattttctcgtaaaatggggctctagtgtaacgatatcaagtagaagttgttgaatactcccctaatgatttgaagaccattctcctcggt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34583875 |
gctagtgtggattttctcgtaaaatggggctctagtgtaacgatatcaagtagaagttgttgaatactcccctaatgatttgaagaccattctcctcggt |
34583974 |
T |
|
| Q |
296 |
ggttccttgaggacccttgctcc |
318 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34583975 |
ggttccttgaggacccttgctcc |
34583997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 113; Significance: 4e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 13753403 - 13753203
Alignment:
| Q |
1 |
gcaccagaatcctacccgcttcatttctgggcatacttctagagaaaattgtttagtcataaatgttgatggtagttgtagcggtcattctggccatgct |
100 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| | | ||| |
|
|
| T |
13753403 |
gcaccagaatcctacacgcttcatttcttggcatccttctagagaaaattgtttagtcctaaatgttgatggtagttgtagcggtaattcttgtcgggct |
13753304 |
T |
|
| Q |
101 |
ggagct-ggggtctgattaggcgtggtgatggcagctggg-ttgtcgagttcagcagttacctaggactttccaataacaactatgcagaaatcatggct |
198 |
Q |
| |
|
|||||| ||||| ||||||| | ||||||||||||||||| || || ||||||||| |||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
13753303 |
ggagctgggggtatgattagacatggtgatggcagctgggtttttcaggttcagcagctacctaggactttccaataacacctatgcagaaatcattgct |
13753204 |
T |
|
| Q |
199 |
a |
199 |
Q |
| |
|
| |
|
|
| T |
13753203 |
a |
13753203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 196 - 267
Target Start/End: Complemental strand, 13753005 - 13752936
Alignment:
| Q |
196 |
gctagtgtggattttctcgtaaaatggggctctagtgtaacgatatcaagtagaagttgttgaatactcccc |
267 |
Q |
| |
|
||||||| ||||||||||| ||| |||||||||| ||||||| ||||||| ||||||| |||||| |||| |
|
|
| T |
13753005 |
gctagtgcggattttctcgcaaagtggggctcta--gtaacgacatcaagtggaagttgcggaatacccccc |
13752936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University