View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18527_low_36 (Length: 238)
Name: NF18527_low_36
Description: NF18527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18527_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 45037755 - 45037938
Alignment:
| Q |
1 |
ccttcagcagcttaaactgagctgttttttggtgaccattcattcgtgcaatggaagcaaaaacataaaaaatgaagtaaggaataacgatggaaattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037755 |
ccttcagcagcttaaactgagctgttttttggtgaccattcattcgtgcaatggaagcaaaaacataaaaaatgaagtaaggaataacgatggaaattat |
45037854 |
T |
 |
| Q |
101 |
tatggaagtgagtaaaaaagtttaggtgcaaccgttctagaannnnnnncaagaccaggggaaatggttggtgctatatttcagc |
185 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45037855 |
tatggaagtgagt-aaaaagtttaggtgcaaccgttcaagaatttttttcaagacaaggggaaatggttggtgctatatttcagc |
45037938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University