View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18527_low_39 (Length: 236)
Name: NF18527_low_39
Description: NF18527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18527_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 9220250 - 9220029
Alignment:
| Q |
18 |
tcaactgtgtttttgtgtagtcatatatatgatataattaagcataataaatttcaatagaacttcactttttggtgtaaaattgttggctaaaaaattt |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9220250 |
tcaactgtgttttagtgtagtcatatatatgatataattaagcataaaaaatttcaacagaacttcactttttggtgtaaaattgttggctaaaaaattt |
9220151 |
T |
 |
| Q |
118 |
gaaattcaatcctactcccgacatgatatcagt---aaataataccaatattaaaattgnnnnnnnnnnatac-atattttataagttttgggtgcgatc |
213 |
Q |
| |
|
||||||||||||||||||||| |||||| | | ||||||||||||||||| ||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
9220150 |
gaaattcaatcctactcccgatatgataataataccaaataataccaatattacaattggtttttctttctacaattttttataagttttgggtgcgatc |
9220051 |
T |
 |
| Q |
214 |
ttaggtgaaatactttgatatt |
235 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9220050 |
ttaggtgaaatactttgatatt |
9220029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University