View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18528_high_2 (Length: 471)
Name: NF18528_high_2
Description: NF18528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18528_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 73 - 460
Target Start/End: Complemental strand, 10930754 - 10930367
Alignment:
| Q |
73 |
gtccaatctatctccgtttccgataatctcatcctcattgccgccaccactcataatctcaccccagcactctcccatcctttgattttcaacccaagtc |
172 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10930754 |
gtccaatctatctccgtctccgataatctcatcctcctcgccgccaccactcataatctcaccccagcactatcccatcctttgattttcaacccaagtc |
10930655 |
T |
 |
| Q |
173 |
agggctggtctgtcggacctgccctaactaatccacgccgctggtgtgcattaggcacatcagaaggtatggtctatgtagcaagtggtattgggtccca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10930654 |
agggctggtctgtcggacctgccctaactaatccacgccgctggtgtgcattaggcacatcagagggtatggtctatgtagcaagtggtattgggtccca |
10930555 |
T |
 |
| Q |
273 |
tttctcagttgatgtagcaaagtcaatagagaagtgggacccgatcaacgatcccatttgggagaagaaaaccgatatgaaggacggcagattcagcagg |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10930554 |
tttctcagttgatgtagcaaagtcaatagagaagtgggacccgatcaacgatcccatttgggagaagaaaaccgatatgaaggacggcagattcagcagg |
10930455 |
T |
 |
| Q |
373 |
gaagctgtagatgctgtaggatggagaggaaagctttatatggtaaacgtaaaaggcgatgctgctaaagaaggagttgtgtatgatg |
460 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10930454 |
gaagctgtagatgctgttggatggagaggaaagctttatatggtaaacgtaaaaggcgatgctgctaaagaaggagttgtgtatgatg |
10930367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University