View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18529_low_2 (Length: 446)
Name: NF18529_low_2
Description: NF18529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18529_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 5 - 430
Target Start/End: Original strand, 16385824 - 16386249
Alignment:
| Q |
5 |
ccaccatctacttattctctacccaccnnnnnnngaataaccgcccttcaaccccaccttcaccaccacaataacatcccaaacgacgctgttccgctca |
104 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16385824 |
ccaccatctacttattctctacccaccaaaaaaagaataaccgcccttcaaccccaccttcaccaccacaataacatcccaaacgatgctgttccgctca |
16385923 |
T |
 |
| Q |
105 |
tcgatctcaacgtcgaatacagtccttctctcccatcacccaccccaatcgaaaaacaatctcaaaaacaggacattgaatttgaagtcgatgaggatga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16385924 |
tcgatctcaacgtcgaatacagtccttctctcccatcagccaccccaatcgaaaaacaatctcaaaaacaggacattgaatttgaagtcgatgatgatga |
16386023 |
T |
 |
| Q |
205 |
aattttatgctgtgtgtgccatagcacagacgctaatgcggaggatccaatcgttttctgcgacggttgtaacttaatggtccatgcttcctgctatggt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16386024 |
aattttatgctgtgtgtgccatagcacagacgctaatgctgaggatccaatcgttttctgcgacggttgtaacttaatggtccatgcttcctgctatggt |
16386123 |
T |
 |
| Q |
305 |
aaccctctggtgaaacagatcccagagggtgattggttttgtgatcagtgtcgttttaaaaacgacactgatactgacaccggtccaattcgttgctccc |
404 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16386124 |
aaccctctggtgaaacagatcccagatggtgactggttttgcgatcagtgtcgttttaaaaacgacattgatactgacaccggtccaattcgttgctccc |
16386223 |
T |
 |
| Q |
405 |
tctgtcctacgaaagagggagcaatg |
430 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
16386224 |
tctgtcctacgaaagagggagcaatg |
16386249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University