View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18529_low_7 (Length: 230)
Name: NF18529_low_7
Description: NF18529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18529_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 210
Target Start/End: Original strand, 9074713 - 9074909
Alignment:
| Q |
14 |
agaatataggtctgtttatagtatgcaacgctaaagtactatagtgccgctatagcggctatttgacaaaactttgtgataaatacgcggaacaatagca |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9074713 |
agaaaataggtctgtttatagtatgcaacgctaaagtactatagtgccgctatagcggctatttgacaaaactttgtgataaatacgcggaacaatagca |
9074812 |
T |
 |
| Q |
114 |
atctgtacgaatagcggtatagcgtcgcagtttgacaacactggtctacatgtacagtgatgtgaatgtttataggttagtcttagaaaacctagct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9074813 |
atctgtacgaatagcggtatagcgtcgctgtttgacaacactggtctacatgtacagtgatgtgaatgtttataggttagtcttagaaaacctagct |
9074909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University