View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1852_high_20 (Length: 352)
Name: NF1852_high_20
Description: NF1852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1852_high_20 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 321; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 16 - 352
Target Start/End: Original strand, 34375448 - 34375784
Alignment:
| Q |
16 |
ttcatctttggggagtcttgagcatcttgaaaagctagaagtacgaaattgcaagaacatgcaagaaatagtatctctagaagaaagttcaaataagatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34375448 |
ttcatctttggggagtcttgagcatcttgaaaagctagaagtacgaaattgcaagaacatgcaagaaatagcatctctagaagaaagttcaaataagatt |
34375547 |
T |
|
| Q |
116 |
gtgttacataggttgaagcatctaattcttcaggagctacccaaccttaaagccttttgcctaagttcctgtgatgtctttttcccgtcattgcaaaaaa |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34375548 |
gtgttacataggttgaaacatctaattcttcaggagctacccaaccttaaagccttttgcctaagttcatgtgatgtctttttcccgtcattgcaaaaaa |
34375647 |
T |
|
| Q |
216 |
tggaaattaatgattgtcccaatatggaagttttttcactaggattttgtactacaccagtgcttgtggatgtcacaatgaggcaatcatcactcaatat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34375648 |
tggaaattaatgattgtcccaatatggaagttttttcactaggattttgtactacacctgtgcttgtggatgtcacaatgaggcaatcatcactcaatat |
34375747 |
T |
|
| Q |
316 |
tagaggctatatacagaagacagacatcaatgatatt |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34375748 |
tagaggctatatacagaagacagacatcaatgatatt |
34375784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 273
Target Start/End: Complemental strand, 34563471 - 34563425
Alignment:
| Q |
227 |
gattgtcccaatatggaagttttttcactaggattttgtactacacc |
273 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||| ||| |||||| |
|
|
| T |
34563471 |
gattgtcccaatatggaacttttttcacgaggatttagtagtacacc |
34563425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University