View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1852_low_23 (Length: 343)
Name: NF1852_low_23
Description: NF1852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1852_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 18 - 327
Target Start/End: Complemental strand, 34248302 - 34247993
Alignment:
| Q |
18 |
gaagctattgtgccttgtgacttcaatcttatcactggtttgtatcaacttctctcgtgataaaacttatgtcgcgatttagttacaaaattgtttatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34248302 |
gaagctattgtgccttgtgacttcaatcttatcactggtttgtatcaacttctctcttgataaaacttatgtcgcgatttagttacaaaattgtttatga |
34248203 |
T |
 |
| Q |
118 |
tgttactagctcaagttcatatgnnnnnnnntcacatttaaaattgcagagtagtctatgtgaactatagaattttcttagatatttgaactatgtgaca |
217 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34248202 |
tgttactagctcgagttcatatgaaaaaaaatcacatttaaaattgcagagtagtctatgtgaactatagaattttcttagatatttgaactatgtgaca |
34248103 |
T |
 |
| Q |
218 |
acccaaatgccatttagaaactatgtataaaactaatacttttatttctatcattgtcgtatactgtatagatttggacttcagacaactagtaaatcgg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34248102 |
acccaaatgccatttagaaactatgtataaaactaatacttttatttctatcattgtcgtatactgtatagatttggacttcagacaactagtaaatcgg |
34248003 |
T |
 |
| Q |
318 |
attccaaaag |
327 |
Q |
| |
|
|||||||||| |
|
|
| T |
34248002 |
attccaaaag |
34247993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University