View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1852_low_38 (Length: 257)
Name: NF1852_low_38
Description: NF1852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1852_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 44628324 - 44628561
Alignment:
| Q |
1 |
gtgtttatcgtcaaattgctaaatgctgaaagcgtaatgctgataaatagtcactttctagttaaagctagggagacataatcccctatagaatttaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44628324 |
gtgtttatcgtcaaattgctaaatgctgaaagcgtaatgctgataaatagtcactttctagttaaagctagggagacataatcccctatagaatttaact |
44628423 |
T |
 |
| Q |
101 |
tgaccttttttgtcttcaaatttcattctgattttctgctcctgttcaatgatatcatttcaattcattggttctgttcttcatatgcatttatttatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44628424 |
tgaccttttttgtcttcaaatttcattctgattttctgctcctgttcaatgatatcatttcaattcattggttttgttcttcatatgcatttatttatca |
44628523 |
T |
 |
| Q |
201 |
agtgtcattgttggctctggatggaagataacggttaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44628524 |
agtgtcattgttggctctggatggaagataacagttaa |
44628561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 131 - 194
Target Start/End: Original strand, 26081651 - 26081715
Alignment:
| Q |
131 |
attttctgctcctgttcaatgatatcatttcaattcattggttctgttcttcat-atgcatttat |
194 |
Q |
| |
|
||||||||| | |||||||||||||| ||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
26081651 |
attttctgcactagttcaatgatatcacttcaagtcattggttttgttcttcctcatgcatttat |
26081715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University