View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1852_low_45 (Length: 245)
Name: NF1852_low_45
Description: NF1852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1852_low_45 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 9 - 245
Target Start/End: Original strand, 9574731 - 9574969
Alignment:
| Q |
9 |
tcaagcgaggttatgatattatgttggatcttcataggagtttcttgaagaaccactgagttttgcctttgtattcacatgtgtgggtgatgacttgcca |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9574731 |
tcaagcgaggctatgatattatgttggatcttcataggggtttcatgaagaaccactgagttttgcctttgtattcacatgtatgggtgatgacttgcca |
9574830 |
T |
|
| Q |
109 |
gcagacatacatgtgtgctcaataacttcctctgcatatttattttgagaaagaaaaataactggacggg--tgatgacttcacgaaaaattcaaagtta |
206 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||| | |||||||||||||| |
|
|
| T |
9574831 |
gtagacatacatgtgtgctcaataacttcctctgcatatttattttgagaaagaaaaataactggacgggcctcaatccttcatggaaaattcaaagtta |
9574930 |
T |
|
| Q |
207 |
agcttagacataatcaattcataaagagagtcagaagaa |
245 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9574931 |
agcttagacataatcaattcataaagatagtcagaagaa |
9574969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University