View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1852_low_57 (Length: 204)
Name: NF1852_low_57
Description: NF1852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1852_low_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 197
Target Start/End: Original strand, 2600674 - 2600854
Alignment:
| Q |
17 |
tgatcgttgaccctttttcccaaaaggactacagaatccacacgcagagacctttggagacggtggttcgatcgctggtgaaacttttccggtacggtat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2600674 |
tgatcgttgaccctttttcccaaaaggactacagaatccacacgcggagacctttggagacggtggttcgatcgctggtgaaacttttccggtacggtat |
2600773 |
T |
|
| Q |
117 |
cctcgtccagcaccggtggagcggcttctttgtacggtggttttcacatgaagctctttggaattattagtagtattatct |
197 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2600774 |
cctcttccagcaccggtggaatggcttctttgtacggtggttttcacacgaagctctttggaattattagtagtattatct |
2600854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 148
Target Start/End: Complemental strand, 44510605 - 44510489
Alignment:
| Q |
32 |
tttcccaaaaggactacagaatccacacgcagagacctttggagacggtggttcgatcgctggtgaaacttttccggtacggtatcctcgtccagcaccg |
131 |
Q |
| |
|
||||||||||| || ||| || ||||| ||||| | | | ||||||||||| || ||||| || |||||||||||||||||||| || ||||| ||||| |
|
|
| T |
44510605 |
tttcccaaaagcaccacaaaacccacaagcagaaatcctaggagacggtggctcaatcgccggagaaacttttccggtacggtaaccacgtcctccaccg |
44510506 |
T |
|
| Q |
132 |
gtggagcggcttctttg |
148 |
Q |
| |
|
|||| || |||||||| |
|
|
| T |
44510505 |
ttggaacgacttctttg |
44510489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University