View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18530_low_11 (Length: 206)
Name: NF18530_low_11
Description: NF18530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18530_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 11 - 114
Target Start/End: Original strand, 2697551 - 2697654
Alignment:
| Q |
11 |
gaagaatatggggatgatgatcttgaacttgaagaaagacttccttctcttggtgatggtttctatgagattgaagctattcgtcgtaagagataccgca |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2697551 |
gaagaaaatggggatgatgatcttgaacttgaagaaagacttccttctcttggtgatggtttctatgagattgaagctattcgtcgtaagagataccgca |
2697650 |
T |
|
| Q |
111 |
aggt |
114 |
Q |
| |
|
|||| |
|
|
| T |
2697651 |
aggt |
2697654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University