View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18531_high_2 (Length: 235)
Name: NF18531_high_2
Description: NF18531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18531_high_2 |
 | |
|
| [»] scaffold0132 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0132 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: scaffold0132
Description:
Target: scaffold0132; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 1977 - 1756
Alignment:
| Q |
1 |
gtgaaaagtaagggtgtcaaattataattgctctttatttattggtctggtgttggttgttatgtcgcggatattgttttgattttttgtggttctttag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1977 |
gtgaaaagtaagggtgtcaaattataattgctctttatttattggtctggtgttggttgttatgtcgcggatattgttttgattttttgtggtgctttag |
1878 |
T |
|
| Q |
101 |
tgtggtttgtgcagattcttaa---gttcttccgttgcttcatgttgatcgggttagtcaggtgttggtttggttttaggtgttccagctatatacaacg |
197 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
1877 |
tgtggtttgtgcagattcttaagacgttcttccgttgcttcatgttgatcgggtaagtcgggtgttggtttgattttaggtgttccacctatatacaacg |
1778 |
T |
|
| Q |
198 |
atccctttctttgtatctccat |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1777 |
atccctttctttgtatctccat |
1756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0132; HSP #2
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 9937 - 9716
Alignment:
| Q |
1 |
gtgaaaagtaagggtgtcaaattataattgctctttatttattggtctggtgttggttgttatgtcgcggatattgttttgattttttgtggttctttag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9937 |
gtgaaaagtaagggtgtcaaattataattgctctttatttattggtctggtgttggttgttatgtcgcggatattgttttgattttttgtggtgctttag |
9838 |
T |
|
| Q |
101 |
tgtggtttgtgcagattcttaa---gttcttccgttgcttcatgttgatcgggttagtcaggtgttggtttggttttaggtgttccagctatatacaacg |
197 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
9837 |
tgtggtttgtgcagattcttaagacgttcttccgttgcttcatgttgatcgggtaagtcgggtgttggtttgattttaggtgttccacctatatacaacg |
9738 |
T |
|
| Q |
198 |
atccctttctttgtatctccat |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
9737 |
atccctttctttgtatctccat |
9716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University