View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18531_low_6 (Length: 215)

Name: NF18531_low_6
Description: NF18531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18531_low_6
NF18531_low_6
[»] scaffold0132 (2 HSPs)
scaffold0132 (1-203)||(2157-2359)
scaffold0132 (1-203)||(10117-10319)


Alignment Details
Target: scaffold0132 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: scaffold0132
Description:

Target: scaffold0132; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 2359 - 2157
Alignment:
1 cggctgttcttgtggtttcatctttggagcggttttttgttacagttttgtgttttcctggatatcagctgttgttcctggcagtgattaagttttaggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2359 cggctgttcttgtggtttcatctttggagcggttttttgttacagttttgtgttttcctggatatcagctgttgttcctggcagtgattaagttttaggt 2260  T
101 ccccacacaactctccaggagggtcaggagctatttctggcagttttgaagttattttagcactcgtgtggggggcagtatgcttttcgggagatggtgc 200  Q
    |||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
2259 ccccacgcaactctccaggagggtcaggagctatttttggcagtgttgaagttattttagcactcgtgtggggggcagtacgcttttcgggagatggtgc 2160  T
201 cta 203  Q
    |||    
2159 cta 2157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0132; HSP #2
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 10319 - 10117
Alignment:
1 cggctgttcttgtggtttcatctttggagcggttttttgttacagttttgtgttttcctggatatcagctgttgttcctggcagtgattaagttttaggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10319 cggctgttcttgtggtttcatctttggagcggttttttgttacagttttgtgttttcctggatatcagctgttgttcctggcagtgattaagttttaggt 10220  T
101 ccccacacaactctccaggagggtcaggagctatttctggcagttttgaagttattttagcactcgtgtggggggcagtatgcttttcgggagatggtgc 200  Q
    |||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
10219 ccccacgcaactctccaggagggtcaggagctatttttggcagtgttgaagttattttagcactcgtgtggggggcagtacgcttttcgggagatggtgc 10120  T
201 cta 203  Q
    |||    
10119 cta 10117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University