View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18532_high_43 (Length: 237)
Name: NF18532_high_43
Description: NF18532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18532_high_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 21 - 220
Target Start/End: Complemental strand, 39510005 - 39509806
Alignment:
| Q |
21 |
agaggtcttcaataccttcacaaaggggcagctggtggtatcattcaccgcgatgtaaaatccacaaacatattgcttgatgaccatcttgttgctaaag |
120 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||| || ||||| ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
39510005 |
agaggtcttcattaccttcacaaaggagcagctggtggaatcattcaccgcgatgtgaagtccactaacatattgcttgatgagcatcttgtagctaaag |
39509906 |
T |
|
| Q |
121 |
ttgctgattttggtctttcaagaactggtcctcttgatcagcattcttatgtcaacacaggtgttaagggaactttcggttatctcgatcctgagtactt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39509905 |
ttgctgattttggtctttcaagaactggtcctcttgatcagcattcttatgtcagcacaggtgttaagggaactttcggttatctcgatcctgagtactt |
39509806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 21 - 220
Target Start/End: Complemental strand, 39543070 - 39542871
Alignment:
| Q |
21 |
agaggtcttcaataccttcacaaaggggcagctggtggtatcattcaccgcgatgtaaaatccacaaacatattgcttgatgaccatcttgttgctaaag |
120 |
Q |
| |
|
||||||||||| |||||||||||||| | ||||||||| || |||||||| || || |||||||| || |||||||||||||| ||||||| ||||||| |
|
|
| T |
39543070 |
agaggtcttcattaccttcacaaaggagtagctggtggaataattcaccgtgacgtgaaatccactaatatattgcttgatgagaatcttgtagctaaag |
39542971 |
T |
|
| Q |
121 |
ttgctgattttggtctttcaagaactggtcctcttgatcagcattcttatgtcaacacaggtgttaagggaactttcggttatctcgatcctgagtactt |
220 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||| | ||||||||||||| |||| ||||||| || ||||| || ||||| |||||||| ||||| |
|
|
| T |
39542970 |
ttgctgattttggtctttcaaggacaggtcctcttgatgaacattcttatgtcagcacacgtgttaaagggacttttgggtatcttgatcctgattactt |
39542871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 21 - 220
Target Start/End: Complemental strand, 39574905 - 39574706
Alignment:
| Q |
21 |
agaggtcttcaataccttcacaaaggggcagctggtggtatcattcaccgcgatgtaaaatccacaaacatattgcttgatgaccatcttgttgctaaag |
120 |
Q |
| |
|
||||||||||| |||||||||||||| | ||| ||||| || || ||||| ||||| |||||||| || ||||||||||| || ||||||| ||||||| |
|
|
| T |
39574905 |
agaggtcttcattaccttcacaaaggagtagccggtggaataatccaccgtgatgtgaaatccactaatatattgcttgacgagaatcttgtagctaaag |
39574806 |
T |
|
| Q |
121 |
ttgctgattttggtctttcaagaactggtcctcttgatcagcattcttatgtcaacacaggtgttaagggaactttcggttatctcgatcctgagtactt |
220 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| ||||||||||||| |||| ||||||| || ||||| || ||||| ||||| || ||||| |
|
|
| T |
39574805 |
ttgctgattttggtctttcaaggacaggtcctcttgatcaacattcttatgtcagcacatgtgttaaagggacttttgggtatcttgatccggattactt |
39574706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 21 - 220
Target Start/End: Complemental strand, 39579438 - 39579239
Alignment:
| Q |
21 |
agaggtcttcaataccttcacaaaggggcagctggtggtatcattcaccgcgatgtaaaatccacaaacatattgcttgatgaccatcttgttgctaaag |
120 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||| || || ||||| ||||| |||||||| || |||||||||||||| ||||||||||||||| |
|
|
| T |
39579438 |
agaggtcttcattaccttcacaaaggagttgctggtggaataatccaccgtgatgtgaaatccactaatatattgcttgatgagaatcttgttgctaaag |
39579339 |
T |
|
| Q |
121 |
ttgctgattttggtctttcaagaactggtcctcttgatcagcattcttatgtcaacacaggtgttaagggaactttcggttatctcgatcctgagtactt |
220 |
Q |
| |
|
||||||||||||| ||||||| | |||||||||||||| ||||||||||| | |||||||||||| || ||||| || ||||| |||||||| ||||| |
|
|
| T |
39579338 |
ttgctgattttggcctttcaaaggcaggtcctcttgatcaacattcttatgtgagcacaggtgttaaagggacttttgggtatcttgatcctgattactt |
39579239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University